WormMine: Gene WBGene00129335

• WormBase Gene ID: WBGene00129335
• Gene Name: Cjp-acs-17
• Sequence Name: CJA10131
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: AMP-dependent synthetase/ligase; AMP-binding enzyme C-terminal domain; ANL, N-terminal domain; AMP-binding enzyme, C-terminal domain; AMP-binding enzyme; and AMP-binding. Is an ortholog of C. elegans acs-17.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA10131.1	CJA10131.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA10131	CJA10131		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1089885
• Remark: Cjp-acs-17, GAAATTGCAACGCGTTGAAATCCCACAGAAACTCTTTGTTTGCCACGAACCATGGACGCC, WBGene00129335
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term