WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00040803 Gene Name  Cbr-ppfr-1
Sequence Name  ? CBG22183 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Armadillo-type fold and Armadillo-like helical. Is an ortholog of C. elegans ppfr-1. In C. elegans, ppfr-1 is involved in several processes, including establishment of mitotic spindle orientation; polar body extrusion after meiotic divisions; and regulation of spindle elongation. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

7 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG22183b.1 CBG22183b.1   [unknown]
Transcript:CBG22183a.1 CBG22183a.1   [unknown]
Transcript:CBG22183f.1 CBG22183f.1   [unknown]
Transcript:CBG22183e.1 CBG22183e.1   [unknown]
Transcript:CBG22183d.1 CBG22183d.1   [unknown]
Transcript:CBG22183c.1 CBG22183c.1   [unknown]
Transcript:CBG22183g.1 CBG22183g.1   [unknown]
 

Other

7 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG22183f CBG22183f   [unknown]
CDS:CBG22183g CBG22183g   [unknown]
CDS:CBG22183d CBG22183d   [unknown]
CDS:CBG22183e CBG22183e   [unknown]
CDS:CBG22183b CBG22183b   [unknown]
CDS:CBG22183c CBG22183c   [unknown]
CDS:CBG22183a CBG22183a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-ppfr-1, CCAACCACAACAAACGTCATCGCCATTCCAATCACTGAGAATGCCACGTCACCAGAAGAT, WBGene00040803   Expr1059858 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG22188, GCTCGTTGAAAGCCATCGCGTTTCGATTACCGTTCGATTTGATTCTAAACGAGGATAATA, WBGene00040804   Expr1069889 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term