WormMine: Gene WBGene00040036

• WormBase Gene ID: WBGene00040036
• Gene Name: Cbr-daf-41
• Sequence Name: CBG21192
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: HSP20-like chaperone. Is an ortholog of C. elegans daf-41.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21192a.1	CBG21192a.1		[unknown]
Transcript:CBG21192b.1	CBG21192b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21192a	CBG21192a		[unknown]
CDS:CBG21192b	CBG21192b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly decreased at L1 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L1_vs_embryo_downregulated

1 Expression Patterns

• Primary Identifier: Expr1067515
• Remark: CBG21192, AAGGGAAAGGTTCACTGGTTGAAGGTTGATTTTGGAAAGTGGAAGGACGAGGATGAGGAT, WBGene00040036
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term