WormMine: Gene WBGene00040501

• WormBase Gene ID: WBGene00040501
• Gene Name: Cbr-zig-11
• Sequence Name: CBG21818
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Immunoglobulin subtype; Basigin-like; Immunoglobulin I-set; Immunoglobulin subtype 2; Immunoglobulin I-set domain; Immunoglobulin-like fold; and Immunoglobulin-like domain superfamily. Is an ortholog of C. elegans zig-11.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21818a.1	CBG21818a.1		[unknown]
Transcript:CBG21818b.1	CBG21818b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21818b	CBG21818b		[unknown]
CDS:CBG21818a	CBG21818a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053818
• Remark: CBG21818, TTTATCATTATCTTCGCATGCAACAGTGCGCCAAGTACAAGGCCGATCAGTACAACGTGG, WBGene00040501
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term