WormMine: Gene WBGene00040571

• WormBase Gene ID: WBGene00040571
• Gene Name: Cbr-ztf-2
• Sequence Name: CBG21899
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: C2H2-type zinc-finger domain; Zinc finger C2H2-type; and Zinc finger C2H2 superfamily. Is an ortholog of C. elegans ztf-2. In C. elegans, ztf-2 is involved in negative regulation of transcription by RNA polymerase II and nematode pharynx morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21899.1	CBG21899.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21899	CBG21899		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055629
• Remark: Cbr-ztf-2, CTAGCGGGCCTTGCGGTCATGTGGATATGATTTATAATGTGATGCCGACTTATGAGAAAG, WBGene00040571
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term