WormMine: Gene WBGene00030673

• WormBase Gene ID: WBGene00030673
• Gene Name: CBG08997
• Sequence Name: CBG08997
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: THAP-type zinc finger superfamily; THAP-type zinc finger; and THAP domain. Is an ortholog of C. elegans B0336.7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08997a.1	CBG08997a.1		[unknown]
Transcript:CBG08997b.1	CBG08997b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08997a	CBG08997a		[unknown]
CDS:CBG08997b	CBG08997b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057575
• Remark: CBG08997, GTGTGAAAAGCTAATTTCCTGCGATTCTCCATCGATTTGTATTCGAAGGAATTTGTGTGA, WBGene00030673
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term