WormMine: Gene WBGene00071906

• WormBase Gene ID: WBGene00071906
• Gene Name: Cre-ric-8
• Sequence Name: CRE20068
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Guanine nucleotide exchange factor, Ric8; Guanine nucleotide exchange factor synembryn; and Synembryn. Is an ortholog of C. elegans ric-8. In C. elegans, ric-8 is involved in several processes, including negative regulation of protein kinase C signaling; protein localization to cell cortex; and regulation of feeding behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE20068.1	CRE20068.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE20068	CRE20068		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1102182
• Remark: Cre-ric-8, CCACGTGCTCGAATTGCTCAAAGATGCTCCAGAACCGAAACAAGAGAATTCAGACTCTGA, WBGene00071906
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term