WormMine: Gene WBGene00042874

• WormBase Gene ID: WBGene00042874
• Gene Name: Cbr-ctg-1
• Sequence Name: CBG24859
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: CRAL/TRIO domain; CRAL-TRIO lipid binding domain superfamily; GOLD domain superfamily; CRAL/TRIO, N-terminal domain superfamily; and CRAL-TRIO lipid binding domain. Is an ortholog of C. elegans ctg-1. In C. elegans, ctg-1 is involved in regulation of basement membrane organization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG24859.1	CBG24859.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG24859	CBG24859		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069771
• Remark: Cbr-ctg-1, ATGTCCTTGAATTTGACAACTACTACTCGTGGTTCTCAGCTAAACAACTTCGCTACAACA, WBGene00042874
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term