WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00042006 Gene Name  Cbr-taf-5
Sequence Name  ? CBG23733 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: TFIID subunit TAF5, NTD2 domain; TFIID subunit TAF5, NTD2 domain superfamily; G-protein beta WD-40 repeat; LIS1 homology motif; WD40-repeat-containing domain superfamily; WD40 associated region in TFIID subunit, NTD2 domain; WD40/YVTN repeat-like-containing domain superfamily; Transcription initiation factor TFIID subunit 5; WD domain, G-beta repeat; and WD40 repeat. Is an ortholog of C. elegans taf-5. In C. elegans, taf-5 is involved in embryo development and transcription by RNA polymerase II. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG23733.1 CBG23733.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG23733 CBG23733   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-taf-5, AAGGATTCCAACTGGGATCGTATGCAACAAAACAGACTGCTGTCATTGGTCTTCATTTCA, WBGene00042006   Expr1051079 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term