WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00029669 Gene Name  CBG07705
Sequence Name  ? CBG07705 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: CRAL-TRIO lipid binding domain; CRAL-TRIO lipid binding domain superfamily; and CRAL/TRIO domain. Is an ortholog of C. elegans R03A10.5. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG07705.1 CBG07705.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG07705 CBG07705   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG07705, CACGTCGTCACGAAATTCATCAAACAAGGCGGCACCTTAAAATGGTGGGTCCGCGGAAAC, WBGene00029669   Expr1066969 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term