WormMine: Gene WBGene00041573

• WormBase Gene ID: WBGene00041573
• Gene Name: CBG23168
• Sequence Name: CBG23168
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: CRAL/TRIO domain; CRAL-TRIO lipid binding domain superfamily; GOLD domain superfamily; CRAL/TRIO, N-terminal domain superfamily; and CRAL-TRIO lipid binding domain. Is an ortholog of C. elegans T03F7.7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23168.1	CBG23168.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23168	CBG23168		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052699
• Remark: CBG23168, AATGGTGACACCGGGAGAATACATATTGAAGTTCACAAATCCAACGAACACTTGGTTCCC, WBGene00041573
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term