WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00030176 Gene Name  CBG08373
Sequence Name  ? CBG08373 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: TFIIS helical bundle-like domain; Transcription factor IIS, N-terminal; and TFIIS/LEDGF domain superfamily. Is an ortholog of C. elegans F13B12.1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG08373.1 CBG08373.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG08373 CBG08373   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG08373, ATCCGAATGAGACCAAAGAGAACAAGGCGATCGCTAATAAGCTGATTGGAGAGTGGGCGA, WBGene00030176   Expr1057225 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term