WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00121131 Gene Name  Cjp-lpd-3
Sequence Name  ? CJA01927 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Protein KIAA1109; Fragile site-associated protein C-terminus; and Fragile site-associated protein, C-terminal. Is an ortholog of C. elegans lpd-3. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA01927b.1 CJA01927b.1   [unknown]
Transcript:CJA01927a.1 CJA01927a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA01927a CJA01927a   [unknown]
CDS:CJA01927b CJA01927b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-lpd-3, GGAACAGCTGAACGGAGTAGACGACGGCGACAAGTACGAGTCGGTCTTCCAGATGCCAAT, WBGene00121131   Expr1089239 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA01340, TTTCAAACTGAGCAAGGAACGGCACCGCACAAGCCGTCGACGGACAAGAAGCTGATTTAT, WBGene00120544   Expr1076391 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term