WormMine: Gene WBGene00070793

• WormBase Gene ID: WBGene00070793
• Gene Name: Cre-lem-4.1
• Sequence Name: CRE30251
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domain: Ankyrin repeat and LEM domain-containing protein 2. Is an ortholog of C. elegans lem-4. In C. elegans, lem-4 is involved in mitotic nuclear membrane reassembly and positive regulation of protein dephosphorylation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE30251.1	CRE30251.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE30251	CRE30251		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1105124
• Remark: CRE30251, AATACTGGGGGTGATGTCGCATCGATTGTGATGGAAGGATTCAGATATAATGCATTACAT, WBGene00070793
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term