WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00216860 Gene Name  CJA41012
Sequence Name  ? CJA41012 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Ribosomal protein L1, 3-layer alpha/beta-sandwich and Ribosomal protein L1-like. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA41012a.1 CJA41012a.1   [unknown]
Transcript:CJA41012b.1 CJA41012b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA41012a CJA41012a   [unknown]
CDS:CJA41012b CJA41012b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA13257, CAATTGATGTGAAACCATGGCTGCCGGTTCCGACTGAAGAAGAGATTGAGAAGGTAATTA, WBGene00132461   Expr1074967 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term