WormMine: Gene WBGene00126242

• WormBase Gene ID: WBGene00126242
• Gene Name: CJA07038
• Sequence Name: CJA07038
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Serpentine type 7TM GPCR chemoreceptor Srbc and 7TM GPCR, serpentine receptor class bc (Srbc). Is an ortholog of C. elegans srbc-14 and srbc-19.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA07038c.1	CJA07038c.1		[unknown]
Transcript:CJA07038b.1	CJA07038b.1		[unknown]
Transcript:CJA07038a.1	CJA07038a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA07038b	CJA07038b		[unknown]
CDS:CJA07038c	CJA07038c		[unknown]
CDS:CJA07038a	CJA07038a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1082071
• Remark: CJA07038, GAAAGCGCTGGACAGCAGTGTGGTGCAAAGGTCGAAAATGAAGAGTGGGACGACTTTTCC, WBGene00126242
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term