WormMine: Gene WBGene00025710

• WormBase Gene ID: WBGene00025710
• Gene Name: Cbr-bath-38
• Sequence Name: CBG02705
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: MATH domain; MATH/TRAF domain; BTB/POZ domain; TRAF-like; and SKP1/BTB/POZ domain superfamily. Is an ortholog of C. elegans bath-38.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02705.1	CBG02705.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02705	CBG02705		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054514
• Remark: Cbr-bath-38, TGACTGTCACCGCACGCGTTGTTGTACAAAAAGTGTTGGGTGTCAGGAACACACCAAAAT, WBGene00025710
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term