WormMine: Gene WBGene00033503

• WormBase Gene ID: WBGene00033503
• Gene Name: Cbr-cebp-1
• Sequence Name: CBG12574
• Organism: Caenorhabditis briggsae
• Automated Description: Is an ortholog of C. elegans cebp-1 and zip-4. In C. elegans, cebp-1 is involved in several processes, including defense response to bacterium; regulation of extent of cell growth; and regulation of presynapse assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12574.1	CBG12574.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12574	CBG12574		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056818
• Remark: CBG12574, AAATTCAGTGCACGATGTAAAGGTTGAAGAACTCCCCAGCAACCGCTTCCAGCCAGGACC, WBGene00033503
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term