WormMine: Gene WBGene00024329

• WormBase Gene ID: WBGene00024329
• Gene Name: Cbr-aqp-10
• Sequence Name: CBG01036
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Invertebrate aquaporin-10; Aquaporin 11/12; and Aquaporin-like. Is an ortholog of C. elegans aqp-10. In C. elegans, aqp-10 is involved in innate immune response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01036.1	CBG01036.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01036	CBG01036		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051973
• Remark: Cbr-aqp-10, CCATATTCAGCTGCCCATTTGGAGAACGCCAGCAATTTGGATTGTGTTTTGCATTACAAG, WBGene00024329
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term