WormMine: Gene WBGene00038870

• WormBase Gene ID: WBGene00038870
• Gene Name: Cbr-let-767
• Sequence Name: CBG19695
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: NAD(P)-binding domain superfamily; short chain dehydrogenase; and Short-chain dehydrogenase/reductase SDR. Is an ortholog of C. elegans let-767. In C. elegans, let-767 is involved in several processes, including establishment or maintenance of epithelial cell apical/basal polarity; long-chain fatty acid biosynthetic process; and steroid metabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19695.1	CBG19695.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19695	CBG19695		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064254
• Remark: Cbr-let-767, CCATCGCCCCAATGATGGTGGCCACCAAAATGTCCAAAGTGAAAAGAACCTCATTCTTCA, WBGene00038870
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term