WormMine: Gene WBGene00032077

• WormBase Gene ID: WBGene00032077
• Gene Name: Cbr-fhod-1
• Sequence Name: CBG10805
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Formin Homology 2 Domain; Formin, FH2 domain; Armadillo-type fold; Armadillo-like helical; and Formin, FH2 domain superfamily. Is an ortholog of C. elegans fhod-1. In C. elegans, fhod-1 is involved in actin filament organization and embryonic body morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

5 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10805c.1	CBG10805c.1		[unknown]
Transcript:CBG10805d.1	CBG10805d.1		[unknown]
Transcript:CBG10805a.1	CBG10805a.1		[unknown]
Transcript:CBG10805b.1	CBG10805b.1		[unknown]
Transcript:CBG10805e.1	CBG10805e.1		[unknown]

Other

5 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10805a	CBG10805a		[unknown]
CDS:CBG10805b	CBG10805b		[unknown]
CDS:CBG10805c	CBG10805c		[unknown]
CDS:CBG10805d	CBG10805d		[unknown]
CDS:CBG10805e	CBG10805e		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050912
• Remark: Cbr-fhod-1, AAGGAATAAGACACGAGGAAAGATTTGGGCGCTGGAAGGAAGTTCAGATGGCGGGGCAGC, WBGene00032077
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term