WormMine: Gene WBGene00026026

• WormBase Gene ID: WBGene00026026
• Gene Name: Cbr-clec-61
• Sequence Name: CBG03094
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: von Willebrand factor type A domain; C-type lectin-like/link domain superfamily; Lectin C-type domain; von Willebrand factor A-like domain superfamily; von Willebrand factor, type A; C-type lectin-like; and C-type lectin fold. Is an ortholog of C. elegans clec-61. In C. elegans, clec-61 is involved in defense response to Gram-positive bacterium.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03094.1	CBG03094.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03094	CBG03094		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063906
• Remark: Cbr-clec-61.1, GGTTGGAGTGAATGTCCAAACATCACCATCGTCAATGTCGACAGGATGGCAAAATACGAG, WBGene00026024
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term