WormMine: Gene WBGene00134316

• WormBase Gene ID: WBGene00134316
• Gene Name: Cjp-sti-1
• Sequence Name: CJA15112
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Tetratricopeptide repeat 1; Tetratricopeptide repeat; Tetratricopeptide-like helical domain superfamily; and TPR repeat. Is an ortholog of C. elegans sti-1. In C. elegans, sti-1 is involved in determination of adult lifespan and response to heat.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA15112.1	CJA15112.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA15112	CJA15112		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1087990
• Remark: CJA15112, CATGAAGCACTACAACGAAGCTGTGAAGCGCGATCCAGACAATGCGATTCTCTACTCGAA, WBGene00134316
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term