WormMine: Gene WBGene00028484

• WormBase Gene ID: WBGene00028484
• Gene Name: Cbr-par-5
• Sequence Name: CBG06174
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: 14-3-3 protein; 14-3-3 domain superfamily; and 14-3-3 domain. Is an ortholog of C. elegans par-5. In C. elegans, par-5 is involved in several processes, including cell fate commitment; determination of adult lifespan; and establishment of localization in cell.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06174.2	CBG06174.2		[unknown]
Transcript:CBG06174.3	CBG06174.3		[unknown]
Transcript:CBG06174.1	CBG06174.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06174	CBG06174		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055007
• Remark: Cbr-par-5, ACATCGGATGTTGGAGGAGACGATCAAGAGCAGGAGGGAAATCCAGAGGCTGGAAACTAA, WBGene00028484
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term