WormMine: Gene WBGene00032225

• WormBase Gene ID: WBGene00032225
• Gene Name: Cbr-spp-3
• Sequence Name: CBG11015
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Saposin B type domain; Saposin B type, region 2; Saposin-like type B, region 2; and Saposin-like. Is an ortholog of C. elegans spp-3. In C. elegans, spp-3 is involved in defense response to Gram-negative bacterium and defense response to Gram-positive bacterium.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11015.1	CBG11015.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11015	CBG11015		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053649
• Remark: Cbr-spp-3, CCATTCGGAACCCAAGAATGCAGAAAGTTCGTTGACACCAAGCTTGACCCAATCATTCAC, WBGene00032225
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term