WormMine: Gene WBGene00027891

• WormBase Gene ID: WBGene00027891
• Gene Name: CBG05442
• Sequence Name: CBG05442
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Serpentine type 7TM GPCR chemoreceptor Srh and 7TM GPCR, serpentine receptor class h (Srh). Is an ortholog of C. elegans srh-123 and srh-89.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05442.1	CBG05442.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05442	CBG05442		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060742
• Remark: CBG05442, TGGTGACTGGAGTTTCAGCAGTTGGAGGGATTACTCAAAGTCTCACAAATAGTCTTTTTA, WBGene00027891
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term