WormMine: Gene WBGene00027863

• WormBase Gene ID: WBGene00027863
• Gene Name: Cbr-dnj-11
• Sequence Name: CBG05408
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Ribosome-associated complex head domain; SANT/Myb domain; DnaJ domain; Chaperone J-domain superfamily; Myb-like DNA-binding domain; and Homeobox-like domain superfamily. Is an ortholog of C. elegans dnj-11.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05408.1	CBG05408.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05408	CBG05408		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054267
• Remark: Cbr-dnj-11, CTCAAGAAGCATCCAGCAAGTGATCCAGAACGCTGGGAGAAGATCTCAACTGAAGTGGGT, WBGene00027863
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term