WormMine: Gene WBGene00027842

• WormBase Gene ID: WBGene00027842
• Gene Name: Cbr-smg-7
• Sequence Name: CBG05383
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: DNA/RNA-binding domain, Est1-type; Tetratricopeptide-like helical domain superfamily; and Est1 DNA/RNA binding domain. Is an ortholog of C. elegans smg-7. In C. elegans, smg-7 is involved in nuclear-transcribed mRNA catabolic process, nonsense-mediated decay.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05383.1	CBG05383.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05383	CBG05383		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070229
• Remark: Cbr-smg-7, GAAACCAGAATCTTCAGATGAAGAGTGTTTGCAACGAGGTCGTCGACGTGGCAGAGCAGT, WBGene00027842
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term