WormMine: Gene WBGene00035337

• WormBase Gene ID: WBGene00035337
• Gene Name: Cbr-edc-4
• Sequence Name: CBG14967
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: WD40 region of Ge1, enhancer of mRNA-decapping protein; WD40-repeat-containing domain superfamily; Enhancer of mRNA-decapping protein 4, WD40 repeat region; and WD40/YVTN repeat-like-containing domain superfamily. Is an ortholog of C. elegans edc-4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14967c.1	CBG14967c.1		[unknown]
Transcript:CBG14967b.1	CBG14967b.1		[unknown]
Transcript:CBG14967a.1	CBG14967a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14967b	CBG14967b		[unknown]
CDS:CBG14967a	CBG14967a		[unknown]
CDS:CBG14967c	CBG14967c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064135
• Remark: CBG14967, CCACAAAGTTGCATTGTATGAATGTCAGGGCTGGAAATGCCTTGGGCGAATTAGTTTTGA, WBGene00035337
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term