WormMine: Gene WBGene00138659

• WormBase Gene ID: WBGene00138659
• Gene Name: Cjp-taf-5
• Sequence Name: CJA19455
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: TFIID subunit TAF5, NTD2 domain; TFIID subunit TAF5, NTD2 domain superfamily; WD40-repeat-containing domain superfamily; WD40 associated region in TFIID subunit, NTD2 domain; WD40/YVTN repeat-like-containing domain superfamily; Transcription initiation factor TFIID subunit 5; WD domain, G-beta repeat; and WD40 repeat. Is an ortholog of C. elegans taf-5. In C. elegans, taf-5 is involved in embryo development and transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA19455.1	CJA19455.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA19455	CJA19455		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1087856
• Remark: Cjp-taf-5, ATTGGATTGCATTTTACGAGAAGGAATTTGTTATTGGGATTTGGTTGCTTTGGACAGTAA, WBGene00138659
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term