WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00035569 Gene Name  Cbr-orai-1
Sequence Name  ? CBG15255 Organism  Caenorhabditis briggsae
Automated Description  Is affected by Cbr-spr-4 based on RNA-seq studies. Is predicted to encode a protein with the following domains: Calcium release-activated calcium channel protein; Mediator of CRAC channel activity; and Orai superfamily. Is an ortholog of C. elegans orai-1. In C. elegans, orai-1 is involved in ovulation and store-operated calcium entry. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG15255c.1 CBG15255c.1   [unknown]
Transcript:CBG15255b.1 CBG15255b.1   [unknown]
Transcript:CBG15255a.1 CBG15255a.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG15255b CBG15255b   [unknown]
CDS:CBG15255c CBG15255c   [unknown]
CDS:CBG15255a CBG15255a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. DESeq2, FDR < 0.05. WBPaper00059178:Cbr-spr-4(gu163)_upregulated

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG15254, ATACAAGTGCGACGACGCATCATACACTGTCTCCAGTGATACAGTGCTTTCAAAATGATA, WBGene00035568   Expr1062114 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cbr-orai-1, TGGGAATCGTCTTCGTTTTATTCAGTTATCTTATCCACAAGAATCGAGTTTCACACAGTT, WBGene00035569   Expr1057628 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term