WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00035573 Gene Name  CBG15259
Sequence Name  ? CBG15259 Organism  Caenorhabditis briggsae
Automated Description  Is an ortholog of C. elegans Y55B1AR.2. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG15259a.1 CBG15259a.1   [unknown]
Transcript:CBG15259c.1 CBG15259c.1   [unknown]
Transcript:CBG15259b.1 CBG15259b.1   [unknown]
Transcript:CBG15259d.1 CBG15259d.1   [unknown]
 

Other

4 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG15259b CBG15259b   [unknown]
CDS:CBG15259c CBG15259c   [unknown]
CDS:CBG15259d CBG15259d   [unknown]
CDS:CBG15259a CBG15259a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG15259, GTCAGTAGTGTCTTCAGTGCTTCTAGAAGATTCGGGCCTTGTTTTGAACTACAGAAATTC, WBGene00035573   Expr1062004 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term