WormMine: Gene WBGene00034368

• WormBase Gene ID: WBGene00034368
• Gene Name: Cbr-maea-1
• Sequence Name: CBG13627
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Protein Fyv10/E3 ubiquitin-protein transferase MAEA; CRA domain; CTLH, C-terminal LisH motif; and CTLH/CRA C-terminal to LisH motif domain. Is an ortholog of C. elegans maea-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13627.1	CBG13627.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13627	CBG13627		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069801
• Remark: CBG13627, ACGAAGAGCCAATCATAAGGTCTACGATCCAATGCACAAGCAAGAAATCATGGAAGAAGA, WBGene00034368
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term