WormMine: Gene WBGene00029966

• WormBase Gene ID: WBGene00029966
• Gene Name: CBG08105
• Sequence Name: CBG08105
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: cAMP-dependent protein kinase regulatory subunit, dimerization-anchoring domain; P-loop containing nucleoside triphosphate hydrolase; Regulatory subunit of type II PKA R-subunit; IQ calmodulin-binding motif; and IQ motif, EF-hand binding site. Is an ortholog of C. elegans F39H12.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08105.1	CBG08105.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08105	CBG08105		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054572
• Remark: CBG08105, CGCGGATTTCTGACTCGTAAACACGTCGACAAAATGAAGAAGGAAGACACTGAGGCAGCC, WBGene00029966
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term