WormMine: Gene WBGene00029936

• WormBase Gene ID: WBGene00029936
• Gene Name: Cbr-stau-1
• Sequence Name: CBG08071
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Double-stranded RNA binding motif; Double-stranded RNA-binding domain; Staufen C-terminal domain; and Staufen, C-terminal. Is an ortholog of C. elegans stau-1. In C. elegans, stau-1 is involved in germ cell development and negative regulation of post-transcriptional gene silencing by regulatory ncRNA.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08071.1	CBG08071.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08071	CBG08071		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063997
• Remark: CBG08071, ACCGTTGCCTCCACCTGGAAAAAGTCTATTAAAAAAGAACCCTGATGCCGACTATTCTCA, WBGene00029936
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term