WormMine: Gene WBGene00178104

• WormBase Gene ID: WBGene00178104
• Gene Name: CJA22532
• Sequence Name: CJA22532
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Fasciclin domain; FAS1 domain superfamily; SH2 domain superfamily; SH2 domain; and FAS1 domain. Is an ortholog of C. elegans F26E4.7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA22532c.1	CJA22532c.1		[unknown]
Transcript:CJA22532b.1	CJA22532b.1		[unknown]
Transcript:CJA22532a.1	CJA22532a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA22532b	CJA22532b		[unknown]
CDS:CJA22532c	CJA22532c		[unknown]
CDS:CJA22532a	CJA22532a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1086644
• Remark: CJA00273, GCGCGAGGAATGGCAATTGTACCACGAGCAAATCAATTTGGGACGGAAATTGGGCAACGG, WBGene00119476
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term