WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00136397 Gene Name  CJA17192
Sequence Name  ? CJA17192 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Mad3/Bub1 homology region 1; VASt domain; Mad3/BUB1 homology region 1; VAD1 Analog of StAR-related lipid transfer domain; and Membrane-anchored lipid-binding protein Ysp2/Lam4-like. Is an ortholog of C. elegans ZC328.3. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA17192b.1 CJA17192b.1   [unknown]
Transcript:CJA17192a.1 CJA17192a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA17192b CJA17192b   [unknown]
CDS:CJA17192a CJA17192a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA17192, AGGACGTTTATCGAGAAGGGCACAAATCAGGGACTCGATGAGCATTACAAGCTGTTGAAG, WBGene00136397   Expr1076024 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term