WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00023576 Gene Name  Cbr-rgs-2
Sequence Name  ? CBG00085 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: RGS, subdomain 1/3; RGS domain; Regulator of G protein signaling domain; and RGS domain superfamily. Is an ortholog of C. elegans rgs-2. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

5 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG00085a.1 CBG00085a.1   [unknown]
Transcript:CBG00085b.1 CBG00085b.1   [unknown]
Transcript:CBG00085c.1 CBG00085c.1   [unknown]
Transcript:CBG00085d.1 CBG00085d.1   [unknown]
Transcript:CBG00085e.1 CBG00085e.1   [unknown]
 

Other

5 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG00085e CBG00085e   [unknown]
CDS:CBG00085a CBG00085a   [unknown]
CDS:CBG00085b CBG00085b   [unknown]
CDS:CBG00085c CBG00085c   [unknown]
CDS:CBG00085d CBG00085d   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-rgs-2, TTCTCTCTCTCTCCAATCATTTAACTAATTATTTCCAGCTGGACAAAAGTACTTCGCCGA, WBGene00023576   Expr1066498 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG27864, TACCGGATCCAGAACAGCAAGCCACTACATCAAATAACAGAACGGCTGACGCCAATCGCG, WBGene00089278   Expr1065012 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG27861, TGTCATGCACAATGAGCTGCTTTGGGAAATTGATAGTCTGCTTGAATCCAAATGCTTCTA, WBGene00089275   Expr1052951 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term