WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00033010 Gene Name  Cbr-larp-5
Sequence Name  ? CBG11993 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: La domain; Winged helix DNA-binding domain superfamily; La-type HTH domain; and Winged helix-like DNA-binding domain superfamily. Is an ortholog of C. elegans larp-5. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG11993.1 CBG11993.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG11993 CBG11993   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-larp-5, GCCATCATTTGCTTTCGAAGAGAACGCTTTCCCATCTTTGCCGAAAAAGATCGAACCAGT, WBGene00033010   Expr1057105 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term