WormMine: Gene WBGene00025568

• WormBase Gene ID: WBGene00025568
• Gene Name: CBG02527
• Sequence Name: CBG02527
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: Pleckstrin homology domain. Is an ortholog of C. elegans F55C12.5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

5 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02527b.1	CBG02527b.1		[unknown]
Transcript:CBG02527a.3	CBG02527a.3		[unknown]
Transcript:CBG02527a.2	CBG02527a.2		[unknown]
Transcript:CBG02527a.1	CBG02527a.1		[unknown]
Transcript:CBG02527c.1	CBG02527c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02527b	CBG02527b		[unknown]
CDS:CBG02527c	CBG02527c		[unknown]
CDS:CBG02527a	CBG02527a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068565
• Remark: CBG02527, TACACCTCTGATTCTGAATGTTGAAGTCGAAGAAGTCGAAGGACCAATGACTTGTAACAT, WBGene00025568
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term