WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00023818 Gene Name  CBG00429
Sequence Name  ? CBG00429 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Protein kinase-like domain superfamily; Fructosamine/Ketosamine-3-kinase; and Fructosamine kinase. Is an ortholog of C. elegans Y116A8C.25. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG00429c.1 CBG00429c.1   [unknown]
Transcript:CBG00429d.1 CBG00429d.1   [unknown]
Transcript:CBG00429a.1 CBG00429a.1   [unknown]
Transcript:CBG00429b.1 CBG00429b.1   [unknown]
 

Other

4 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG00429d CBG00429d   [unknown]
CDS:CBG00429c CBG00429c   [unknown]
CDS:CBG00429b CBG00429b   [unknown]
CDS:CBG00429a CBG00429a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG00429, TGTTTTTGATCCATCCTCCAGTTATTCGGATCCTGAGTTTGAATTTGGAATTATGCAAAT, WBGene00023818   Expr1068212 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term