WormMine: Gene WBGene00064655

• WormBase Gene ID: WBGene00064655
• Gene Name: Cre-nol-6
• Sequence Name: CRE17931
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Nrap protein, domain 2; NOL6/Upt22; Nrap protein, domain 6; Nrap protein, domain 4; Nrap protein, domain 3; Nrap protein PAP/OAS-like domain; Nrap protein domain 3; Nrap protein, domain 5; Nrap protein domain 1; Nrap protein nucleotidyltransferase domain 4; Nrap protein PAP/OAS1-like domain 5; and Nrap protein domain 6. Is an ortholog of C. elegans nol-6. In C. elegans, nol-6 is involved in negative regulation of innate immune response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE17931.1	CRE17931.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE17931	CRE17931		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1108166
• Remark: Cre-nol-6, GTCGCCATGTTCTTCTACAATAAATACGGTGGTCATCATATTGGAGTGATGTTCAAACCA, WBGene00064655
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term