WormMine: Gene WBGene00031830

• WormBase Gene ID: WBGene00031830
• Gene Name: CBG10443
• Sequence Name: CBG10443
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Domain of unknown function DUF19 and Domain of unknown function (DUF19). Is an ortholog of C. elegans Y73C8C.4; R13D7.2; and C50H11.17.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10443.1	CBG10443.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10443	CBG10443		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054713
• Remark: CBG10443, CGGATAAAGAATGCGTGAAAACATTGATCAAAGCAGAATGCGAGGAAAGCATCATGGAGG, WBGene00031830
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term