WormMine: Gene WBGene00036372

• WormBase Gene ID: WBGene00036372
• Gene Name: CBG16432
• Sequence Name: CBG16432
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Polynucleotide kinase 3 phosphatase; Polynucleotide 3'-phosphatase; HAD superfamily; HAD-superfamily hydrolase,subfamily IIIA; HAD-like superfamily; P-loop containing nucleoside triphosphate hydrolase; and AAA domain. Is an ortholog of C. elegans F21D5.5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16432.1	CBG16432.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16432	CBG16432		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062844
• Remark: CBG16432, TGAGGAGGGATTTCAACAAGTTGTCCGTGTCAACTTCCAGCCGAAATTCCAAATTGAAGA, WBGene00036372
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term