WormMine: Gene WBGene00303349

• WormBase Gene ID: WBGene00303349
• Gene Name: CBG31407
• Sequence Name: CBG31407
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Serpentine type 7TM GPCR chemoreceptor Srx and 7TM GPCR, serpentine receptor class x (Srx). Is an ortholog of C. elegans srx-41.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG31407.1	CBG31407.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG31407	CBG31407		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061422
• Remark: CBG06650, GGATTTCGGTGTGGTTGCAGTTATCGCAGTTGTAGATGTCGTGACAATTGTAATGATAAA, WBGene00028895
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term