WormMine: Gene WBGene00136833

• WormBase Gene ID: WBGene00136833
• Gene Name: CJA17629
• Sequence Name: CJA17629
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Tex-like domain superfamily; Tex-like protein, HTH domain superfamily; Tex-like protein N-terminal domain; and Tex-like protein, N-terminal. Is an ortholog of C. elegans ZK973.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA17629a.1	CJA17629a.1		[unknown]
Transcript:CJA17629b.1	CJA17629b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA17629a	CJA17629a		[unknown]
CDS:CJA17629b	CJA17629b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1091639
• Remark: CJA17629, ATTTGAAGATCTGCTTGGCTGATATGATAAATCGGAACGATGAGGTTAAGAAGGTGGCGT, WBGene00136833
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term