WormMine: Gene WBGene00031132

• WormBase Gene ID: WBGene00031132
• Gene Name: Cbr-ric-4
• Sequence Name: CBG09569
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: SNAP-25 domain; SNAP-25 family; and Target SNARE coiled-coil homology domain. Is an ortholog of C. elegans ric-4. In C. elegans, ric-4 is involved in cholinergic synaptic transmission.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09569b.1	CBG09569b.1		[unknown]
Transcript:CBG09569a.1	CBG09569a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09569b	CBG09569b		[unknown]
CDS:CBG09569a	CBG09569a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054380
• Remark: Cbr-ric-4, ATCGAACGAGGTCCGTGTGGAGTCTGCCAACAAACGCGCAAAGAATCTCATCACCAAATA, WBGene00031132
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term