WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00184279 Gene Name  CJA28705
Sequence Name  ? CJA28705 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Sushi/SCR/CCP domain; Sushi/SCR/CCP superfamily; and Sushi repeat (SCR repeat). Is an ortholog of C. elegans cfh-1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA28705c.1 CJA28705c.1   [unknown]
Transcript:CJA28705b.1 CJA28705b.1   [unknown]
Transcript:CJA28705a.1 CJA28705a.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA28705a CJA28705a   [unknown]
CDS:CJA28705c CJA28705c   [unknown]
CDS:CJA28705b CJA28705b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA28705, GAACTGCCACGTTGCAATGTCAAAGTGGCCAATGGGAACCATCCACTGGATTCGGAAAAT, WBGene00184279   Expr1079879 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term