WormMine: Gene WBGene00184279

• WormBase Gene ID: WBGene00184279
• Gene Name: CJA28705
• Sequence Name: CJA28705
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Sushi/SCR/CCP domain; Sushi/SCR/CCP superfamily; and Sushi repeat (SCR repeat). Is an ortholog of C. elegans cfh-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA28705c.1	CJA28705c.1		[unknown]
Transcript:CJA28705b.1	CJA28705b.1		[unknown]
Transcript:CJA28705a.1	CJA28705a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA28705a	CJA28705a		[unknown]
CDS:CJA28705c	CJA28705c		[unknown]
CDS:CJA28705b	CJA28705b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079879
• Remark: CJA28705, GAACTGCCACGTTGCAATGTCAAAGTGGCCAATGGGAACCATCCACTGGATTCGGAAAAT, WBGene00184279
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term