WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00031246 Gene Name  CBG09705
Sequence Name  ? CBG09705 Organism  Caenorhabditis briggsae
Automated Description  Is an ortholog of C. elegans D1054.9. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

9 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG09705h.1 CBG09705h.1   [unknown]
Transcript:CBG09705i.1 CBG09705i.1   [unknown]
Transcript:CBG09705e.1 CBG09705e.1   [unknown]
Transcript:CBG09705g.1 CBG09705g.1   [unknown]
Transcript:CBG09705f.1 CBG09705f.1   [unknown]
Transcript:CBG09705c.1 CBG09705c.1   [unknown]
Transcript:CBG09705d.1 CBG09705d.1   [unknown]
Transcript:CBG09705a.1 CBG09705a.1   [unknown]
Transcript:CBG09705b.1 CBG09705b.1   [unknown]
 

Other

9 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG09705a CBG09705a   [unknown]
CDS:CBG09705b CBG09705b   [unknown]
CDS:CBG09705e CBG09705e   [unknown]
CDS:CBG09705f CBG09705f   [unknown]
CDS:CBG09705c CBG09705c   [unknown]
CDS:CBG09705d CBG09705d   [unknown]
CDS:CBG09705i CBG09705i   [unknown]
CDS:CBG09705g CBG09705g   [unknown]
CDS:CBG09705h CBG09705h   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG09705, GTTCAAATTCCATACCATCACCAGCATCATCATCATCCAGCTGTACATCGCTATACACCT, WBGene00031246   Expr1059747 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term