WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00031865 Gene Name  CBG10483
Sequence Name  ? CBG10483 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Six-bladed beta-propeller, TolB-like and SMP-30/Gluconolactonase/LRE-like region. Is an ortholog of C. elegans E01A2.8 and poml-4. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG10483.1 CBG10483.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG10483 CBG10483   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
Virus infection: Santeuil infected at L3 larva stage for 12 hours. Transcripts that showed signicantly increased expression after Santeuil virus infection to C. briggsae strain JU1264. edgeR, FDR < 0.05. WBPaper00051137:Santeuil-virus_upregulated_JU1264

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG10483, ATTTCGACTCTAACGGCTTGCGACAATTTTCATATAGATGAAAAGGACAATTTGTGGTCG, WBGene00031865   Expr1069218 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term